grna sgrna sequences flanking ugp2 exon 2 (Synthego Inc)
86
Structured Review
Synthego Inc
grna sgrna sequences flanking ugp2 exon 2
Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/sgrna/pm40769148-755-20-30
Average 86 stars, based on 1 article reviews
Grna Sgrna Sequences Flanking Ugp2 Exon 2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/sgrna/pm40769148-755-20-30
Average 86 stars, based on 1 article reviews
grna sgrna sequences flanking ugp2 exon 2 - by Bioz Stars,
2026-09
86/100 stars
Images
Related Articles
Knock-Out:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Sequencing:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Article Title: Tau uptake by human neurons depends on receptor LRP1 and kinase LRRK2 Article Snippet: .. Article Title: TIGIT contributes to the regulation of 4-1BB and does not define NK cell dysfunction in glioblastoma Article Snippet: gRNA sequence 1: UCUUCCCUAGGAAUGAUGAC , Synthego , N/A. .. Article Title: Combined PD-L1/TGFβ blockade allows expansion and differentiation of stem cell-like CD8 T cells in immune excluded tumors. Article Snippet: .. EMT6 IFNGR1 KO cells were generated at Synthego (Redwood City, CA) using Transduction:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Recombinant:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Transfection:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Clone Assay:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Western Blot:Article Title: Increased translation driven by non-canonical EZH2 creates a synthetic vulnerability in enzalutamide-resistant prostate cancer Article Snippet: .. To knock-out Prkci in Pten f/f Trp53 f/f Rb1 f/f PbCre + organoids, a Generated:Article Title: Combined PD-L1/TGFβ blockade allows expansion and differentiation of stem cell-like CD8 T cells in immune excluded tumors. Article Snippet: .. EMT6 IFNGR1 KO cells were generated at Synthego (Redwood City, CA) using CRISPR:Article Title: Combined PD-L1/TGFβ blockade allows expansion and differentiation of stem cell-like CD8 T cells in immune excluded tumors. Article Snippet: .. EMT6 IFNGR1 KO cells were generated at Synthego (Redwood City, CA) using |
